Direct and Indirect Photochemical Reactions in Viral RNA Measured


Direct and Indirect Photochemical Reactions in Viral RNA Measured...

0 downloads 57 Views 1MB Size

Subscriber access provided by University of Otago Library

Article

Direct and indirect photochemical reactions in viral RNA measured with RT-qPCR and mass spectrometry Zhong Qiao, and Krista R. Wigginton Environ. Sci. Technol., Just Accepted Manuscript • DOI: 10.1021/acs.est.6b04281 • Publication Date (Web): 07 Nov 2016 Downloaded from http://pubs.acs.org on November 12, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Environmental Science & Technology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25

Environmental Science & Technology

1  

Direct and indirect photochemical reactions in viral

2  

RNA measured with RT-qPCR and mass

3  

spectrometry

4  

Zhong Qiao,† and Krista R. Wigginton†* †

5  

Department of Civil and Environmental Engineering,

University of Michigan, Ann Arbor, Michigan 48109, USA

6   7   8   9   10   11   12   13   14   15   16   17  

_____________________________________ *corresponding author: [email protected] Tel. (734) 763-9661 Fax. (734) 764-4292 Word Counts 207 words in Abstract + 4,399 words in Text + 1,800 words in Figures + 600 words in Tables = Total 7,006

 

1   ACS Paragon Plus Environment

Environmental Science & Technology

18  

Abstract: RNA carries the genetic instructions for many viruses to replicate in their host cells.

19  

The photochemical reactions that take place in RNA and affect viral infectivity in natural and

20  

engineered environments, however, remain poorly understood. We exposed RNA oligomer

21  

segments from the genome of bacteriophage MS2 to UV254, simulated sunlight, and singlet

22  

oxygen (1O2), and analyzed the oligomer reaction kinetics with RT-qPCR and quantitative

23  

MALDI-TOF mass spectrometry (MS). Following UV254 exposure, quantitative MALDI-TOF-

24  

MS detected significantly more RNA modifications than RT-qPCR, suggesting that certain

25  

chemical modifications in the RNA were not detected by the reverse transcriptase enzyme. In

26  

contrast, MALDI-TOF-MS tracked as much 1O2-induced RNA damage as RT-qPCR. After 5

27  

hours of simulated sunlight exposure (5100 J/m2 UVB and 1.2 × 105 J/m2 UVA), neither

28  

MALDI-TOF-MS nor RT-qPCR detected significant decreases in the oligomer concentrations.

29  

High-resolution ESI-Orbitrap MS analyses identified pyrimidine photohydrates as the major

30  

UV254 products, which likely contributed to the discrepancy between the MS- and RT-qPCR-

31  

based results. Reactions between RNA oligomers and 1O2 resulted in an unidentified major

32  

product with a mass change of +6 Da. These results shed light on the photochemical reactions

33  

that take place in RNA and suggest that the analytical techniques used to detect RNA reactivity

34  

could bias the observed reaction kinetics.

35   36  

 

2   ACS Paragon Plus Environment

Page 2 of 25

Page 3 of 25

Environmental Science & Technology

37   38  

Introduction

39  

Many illnesses are transmitted by enteric viruses,1 often by exposure to drinking or

40  

recreational waters that have not been appropriately treated. Disinfection is the main line of

41  

defense for inactivating viruses in water. Understanding virus disinfection mechanisms helps

42  

improve treatment technologies and also predict the fate of non-culturable or newly emerged

43  

viruses during disinfection processes. Most enteric viruses are composed of a small RNA or

44  

DNA genome that is protected by a protein capsid. The specific chemical reactions that take

45  

place in viral proteins during disinfection and the biological significance of those reactions have

46  

been the focus of recent studies,2-5 but our understanding of the specific reactions that take place

47  

in viral nucleic acids is more limited.

48  

Disinfection treatments that harness photochemistry, including ultraviolet (UV) germicidal

49  

irradiation and solar water disinfection (SODIS), primarily target the viral genome.6,7

50  

Photochemical reactions in viral genomes can take place via direct or indirect photolysis

51  

pathways.8 In the direct mechanism, viral nucleic acids absorb UV light and then react to form

52  

photoproducts.9 In indirect pathways, exogenous sensitizers outside of the organism (e.g., NOM)

53  

absorb light and then react with the nucleic acids or react with other constituents in the water to

54  

form reactive species (e.g., singlet oxygen (1O2), hydroxyl radical (OH•)) that subsequently react

55  

with the nucleic acids.10 Alternatively, endogenous molecules within the virus particle can also

56  

act as sensitizers.3

57  

Most of the past research on nucleic acid photochemistry has focused on DNA. The major

58  

DNA modifications induced by UV radiation include cis-syn cyclobutane pyrimidine dimers

59  

(CPD), (6-4) photoproducts, and pyrimidine hydrates, with other modifications occurring at

 

3   ACS Paragon Plus Environment

Environmental Science & Technology

60  

lower levels.11 Oxidants that form from indirect photolysis pathways, like 1O2, preferentially

61  

react with guanine bases in DNA,12 although all four bases are susceptible to oxidative damage.13

62  

The oxidation product 8-oxo-7,8-dihydro-2’-deoxyguanosine (8-oxodG) is often used as a

63  

marker of oxidative damage in deoxynucleosides.14-17

64  

Studying the mechanistic fate of viral RNA through photochemical treatment processes

65  

requires both microbiological and analytical methods. Infective viruses can be enumerated before

66  

and after disinfecting treatments, as long as the viruses of interest are culturable.18-20 A number

67  

of important waterborne viruses, however, are not culturable or are difficult to culture with

68  

available cell lines (e.g., human norovirus, hepatitis A virus). Quantitative RT-PCR (RT-qPCR)

69  

is widely used to enumerate viral genomes when viruses are not readily cultureable7,21,22 and to

70  

study the kinetics of reactions that take place in viral genomes.2,23 When used to track genome

71  

inactivation, there is a common assumption that RT-qPCR tracks all of the modifications in

72  

RNA, but the validity of this assumption has not been readily examined.7,24 Reverse transcriptase

73  

has a high error rate;25 for example, it makes inaccurate base modifications while transcribing

74  

RNA into DNA. It is therefore possible that RT-qPCR fails to recognize all RNA modifications

75  

that take place during direct and indirect photolysis reactions, some of which may be important

76  

for virus infectivity.

77  

The goal of this study was to characterize RNA reactions during direct and indirect photolysis.

78  

In particular, we studied direct photolysis by UV254 and sunlight radiation, and indirect

79  

photolysis with 1O2. We focused on 1O2 due to the fact that it is a principal oxidant involved with

80  

virus inactivation in waters containing NOM.26 Using quantitative Matrix Assisted Laser

81  

Desorption Ionization time-of-flight mass spectrometry (MALDI-TOF-MS), high-resolution

82  

Electrospray ionization (ESI) Orbitrap mass spectrometry, and RT-qPCR, we characterized the

 

4   ACS Paragon Plus Environment

Page 4 of 25

Page 5 of 25

Environmental Science & Technology

83  

photolysis reaction kinetics and products in two RNA oligomers from the genome of

84  

bacteriophage MS2.

85   86  

Experimental Methods

87  

Chemicals and reagents

88  

Furfuryl alcohol (98%), THAP (2’-4’-6’ Trihydroxyacetophenone monohydrate), dibasic

89  

ammonium citrate (HOC(CO2H)(CH2CO2NH4)2) and Rose Bengal (dye content 95%) were

90  

purchased from Sigma-Aldrich (St. Louis, MO). HPLC grade acetonitrile (ACN) was purchased

91  

from Acros Organics (New Jersey, USA). UltraPure DNase/RNase-Free distilled water was

92  

purchased from ThermoFisher Scientific, (Grand Island, NY).

93  

 

UV254, solar spectrum, and 1O2 reaction protocols

94   95  

Two RNA oligonucleotides were designed with sequences from selected regions of the

96  

bacteriophage MS2 viral genome (Table 1). Oligomer A was rich in pyrimidine bases, including

97  

several pairs of neighboring pyrimidines, and poor in guanines. Oligomer B was poor in

98  

pyrimidines and rich in guanines. The size of the synthetic RNA oligomers (24-mer) was small

99  

enough for quantitative RNA mass spectrometry measurements and large enough for RT-qPCR

100  

measurements. The photolysis experiments were conducted in DNA/RNAse-free water and run

101  

in triplicate.

102  

In the UV254 irradiation treatments, 20 µL RNA solution in DNase/RNase-free distilled water

103  

(4 µM, pH 6.2) was added to the wells of a 96-well plate (Eppendorf, Hauppauge, NY). The

104  

plate was placed approximately 25 cm below four 15 W germicidal low-pressure mercury vapor

105  

lamps (model G15T8, Philips, Andover, MA) inside a collimated beam unit. Based on chemical

106  

actinometry measurements,27 the UV irradiance was 0.17 mW/cm2 at 254 nm. The RNA  

5   ACS Paragon Plus Environment

Environmental Science & Technology

107  

oligomer samples were irradiated for up to 20 minutes, or a dose of 204 mJ/cm2. Shielding

108  

calculations indicated that 99% of the incident light was transmitted through the sample, thus

109  

shielding corrections were not deemed necessary.

110  

For solar spectrum irradiation and 1O2 experiments, samples of oligomers (1 mL, 1.2 µM)

111  

were pipetted into 5 mm diameter quartz NMR tubes (Wilmand, Vineland, NJ). The tubes were

112  

placed in a test chamber of a Suntest XLS+ solar simulator (Atlas Material Testing Technology,

113  

Mt Prospect, IL). The solar simulator spectrum (300 to 800 nm) was monitored with a built-in

114  

photo-diode detector, with measured irradiances equal to 34 W/m2 and 1.4 W/m2 for the UVA

115  

(320-400 nm) and UVB (280-320 nm) ranges, respectively. This is equivalent to approximately

116  

2.4× and 3.4× the intensity of midday sun in Ann Arbor, MI during the summer (Figure S1). The

117  

temperature in the test chamber was maintained at 25 ºC by an air- and water-cooling system.

118  

For the 1O2 experiments, Rose Bengal was added to the tubes to a concentration of 1.5 mg/L

119  

(1.5 µM). To maintain a constant 1O2 concentration, Rose Bengal was replenished in the

120  

experimental solution to the initial concentration of 1.5 mg/L every 20 minutes. This approach

121  

resulted in a relatively constant 1O2 concentration of 9 x 10-11 M throughout the experiment, as

122  

measured with the 1O2 probe compound furfuryl alcohol (Figure S2).26 Control experiments

123  

conducted either in the dark (i.e. Dark Control) or without Rose Bengal (i.e. No Rose Bengal

124  

Control) were included in each set of 1O2 experiments.

125  

In both the 1O2 experiments and direct photolysis experiments, aliquots of the experimental

126  

solutions were collected from the reaction tubes in the simulator chamber periodically and stored

127  

refrigerated in the dark. The 1O2 experiments were conducted for two hours and the direct

128  

photolysis experiments were conducted for five hours. Samples were analyzed immediately after

129  

the completion of the experiments by RT-qPCR and mass spectrometry.

 

6   ACS Paragon Plus Environment

Page 6 of 25

Page 7 of 25

Environmental Science & Technology

130   131  

Stem-loop primer based RT-qPCR Assay

132  

The stem-loop quantitative RT-qPCR method applied here was originally developed to

133  

quantify MicroRNAs (miRNAs) and therefore works well for RNA oligomers that are 18-25

134  

bases long.28 In brief, stem-loop RNA primers were designed for the two 24-mer RNA targets

135  

(Table 1). The RNA oligomer standards for RT-qPCR calibration curves were prepared at

136  

concentrations between 1.3 × 10-3 and 8.0 × 10-2 pmole/µL (7.5 × 108 and 4.8 × 1010 copies/µL).

137  

The RT reaction solutions (15 µL) consisted of 0.15 µL Deoxynucleotides (dNTPs; 100 mM),

138  

1.00 µL MultiScribe™ Reverse Transcriptase (50 U/µL), 1.50 µL 10X Reverse Transcription

139  

Buffer, 0.19 µL RNase Inhibitor (20 U/µL; TaqMan® MicroRNA Reverse Transcription Kit,

140  

ThermoFisher Scientific, Grand Island, NY), 3.0 µL 5X Stem-loop RT primer (Custom

141  

TaqMan® Small RNA Assay, ThermoFisher Scientific, Grand Island, NY), 4.16 µL nuclease-

142  

free water, and 5.0 µL of the RNA oligomer stock. RT was performed in a thermal cycler

143  

(Eppendorf AG 22331 Hamburg, Hauppauge, NY) at 16 ºC for 30 minutes followed by 42 ºC for

144  

30 minutes. Finally, the preparation was heated at 85 ºC for 5 minutes to denature RNA-DNA

145  

hybrids and inactivate reverse transcriptase. The resulting cDNA was then amplified by qPCR.

146  

The 20 µL qPCR reactions included 1.33 µL of the cDNA solution, 1.00 µL of TaqMan®

147  

Small RNA Assay (20X), 10.00 µL of 2X TaqMan® Universal PCR Master Mix II with UNG

148  

(ThermoFisher Scientific, Grand Island, NY), and 7.67 µL of nuclease-free water. Amplification

149  

and detection were performed with a RealPlex2 Mastercycler system (Eppendorf, Hauppauge,

150  

NY). The amplification procedure included two hold programs, 2 minutes at 50 ºC to activate the

151  

uracil N’-glycosylase and then 10 minutes at 95 ºC to activate the hot start DNA polymerases,

152  

followed by 40 cycles consisting of 15 seconds at 95 ºC and 60 seconds at 60 ºC. Real-time

 

7   ACS Paragon Plus Environment

Environmental Science & Technology

153  

fluorescence measurements were analyzed with the RealPlex system software. Experimental

154  

RNA samples and RNA standards were reverse transcribed and amplified in parallel in each

155  

analysis.

156   157  

MALDI-TOF-MS analysis

158  

The RNA oligomer samples were analyzed with a quantitative MALDI-TOF-MS technique in

159  

negative-ion mode on a Bruker Autoflex Speed system (Madison, WI). A 20 mg/L solution of

160  

THAP in 50% ACN/50% H2O with 50 mg/mL ammonium citrate hydrate was used as the

161  

MALDI matrix. For quantification, a 26-mer internal standard was designed for each viral RNA

162  

segment by adding one adenine (A) and one uracil (U) to the 24-mer sequence at the 3’ end

163  

(Table 1).29 Calibration curves for oligomer quantification were prepared by mixing 1 µM 26-

164  

mer with different 24-mer concentrations, ranging from 0.2 to 2 µM (Figure S3). The resulting

165  

calibration curve R2 values were always greater than 0.99. Following the UV, solar spectrum,

166  

and 1O2 experiments, 5 µL aliquots of the treated oligomer solutions were combined with 5 µL

167  

of the corresponding internal standard solutions with 1 µM as concentration. These mixtures

168  

were then combined with the matrix solution at a 1:1 ratio and spotted on a polished steel

169  

MALDI target plate (Bruker, Madison, WI) and allowed to air dry.

170  

The MALDI mass measurements were calibrated externally with a mixture of five

171  

oligonucleotides ranging in masses from 1488 to 9137 Da. MALDI spectra were generated in

172  

linear mode with 12,000 laser shots randomly collected across the sample spot. Samples were

173  

scanned from 2,000 to 10,000 m/z.

174   175  

ESI-Orbitrap Mass Spectrometry

 

8   ACS Paragon Plus Environment

Page 8 of 25

Page 9 of 25

Environmental Science & Technology

176  

High-resolution mass analyses were performed with a qExactive ESI-Orbitrap mass

177  

spectrometer (Thermo Fisher Scientific, MA, USA) coupled with an EQuan Max Plus LC

178  

system. The samples were separated on a Hypersil GOLD UHPLC column (50 x 2.1 mm, 1.9

179  

µM particle size, Part No.: 25002-052130, Thermo Fisher Scientific, MA, USA). The mass

180  

spectrometer was operated in negative-ion mode with 3.8 kV spray voltage, 320 ºC capillary

181  

temperature and 50 S-lens. The spectrometer was externally calibrated with Pierce ESI Negative

182  

Ion calibration solution (Prod #: 88324, Thermo Fisher Scientific, MA, USA). For each analysis,

183  

15 µL of sample was injected with a mobile phase of 2% Hexafluoro-iso-propanol (HFIP) +

184  

0.4% Triethylamine (TEA) in water and 2% Hexafluoro-iso-propanol (HFIP) + 0.4%

185  

Triethylamine (TEA) in methanol. The gradient information is provided in Table S1. For product

186  

detection and identification, RNA oligomer samples were scanned from 400 to 2000 m/z in full-

187  

scan mode with a resolution power of 70,000. Product fragmentation was performed in Target-

188  

MS-MS mode with isolation as 4 amu and an HCD level of 20. A scan window of m/z 400 to

189  

1200 was collected at a resolution power of 17,500. Mass spectra were processed and analyzed

190  

by Xcalibur Qual Browser software (Thermo Fisher Scientific, MA, USA).

191   192  

Statistical analysis

193  

Details on how rate constants were calculated are presented in the SI. To test whether there

194  

were statistical differences between RNA reaction rate constants measured with RT-qPCR and

195  

mass spectrometry, multiple linear regression analyses were conducted using StatPlus

196  

(AnalystSoft Inc., Walnut, CA). The null hypothesis was that the kinetics from each experiment

197  

were not significantly different. The P values were computed and compared at a confidence level

198  

of 95%.

 

9   ACS Paragon Plus Environment

Environmental Science & Technology

199   200  

Results and Discussion

201  

Prior to conducting the reaction kinetics experiments, we developed the stem-loop RT-

202  

qPCR assay and quantitative MALDI-TOF-MS assay for the two MS2 oligomers. Once

203  

optimized, both quantitative methods resulted in calibration curves with R2 values greater than

204  

0.99 and the stem-loop RT-qPCR efficiencies were consistently greater than 0.85 (Figure S3 and

205  

Figure S4). The calibration curve linear concentration ranges differed between the two

206  

techniques, so that it was necessary to dilute the RNA samples 20-100× prior to RT-qPCR

207  

analysis, but no dilution was necessary for the MALDI-TOF-MS analyses.

208   209  

Direct Photochemical Reactions with UV254

210  

We exposed the two RNA oligomers to UV254 doses up to 204 mJ/cm2, and tracked RNA

211  

reaction kinetics with the quantitative PCR and MS methods. For context, this dose of UV254

212  

causes approximately 5-log inactivation of MS2 virus.2 The two RNA oligomers degraded

213  

significantly during the UV254 experiment (Figure 1) and no RNA loss was detected when

214  

samples were incubated in the dark over the same timeframe. The decay of both oligomers

215  

measured by MALDI-TOF-MS and RT-qPCR followed first order kinetics over the studied dose

216  

range (Figure 1), with Oligomer A reacting at a faster rate than Oligomer B (Table 2). In

217  

particular, the MALDI-TOF-MS results show that 70% of Oligomer A segments reacted after

218  

204 mJ/cm2 of UV254 irradiation, whereas only 32% of Oligomer B segments reacted.

219  

Meanwhile, RT-qPCR results also suggested that Oligomer A reacted faster than Oligomer B

220  

segments following exposure to UV254 (45% and 24%, respectively). Past research on reactions

221  

in nucleic acids suggests that pyrimidine bases are the most reactive with UVC.30-32 We therefore

 

10   ACS Paragon Plus Environment

Page 10 of 25

Page 11 of 25

Environmental Science & Technology

222  

expected Oligomer A to react faster than Oligomer B due to the fact that it contains 17

223  

pyrimidine bases compared to 7 pyrimidine bases.

224  

For each of the two oligomers, the first order rate constants measured by MALDI-TOF-MS

225  

were significantly higher than the rate constants determined by RT-qPCR (Table 2; p < 0.01).

226  

Specifically, Oligomer A and Oligomer B rate constants measured with MALDI-TOF-MS were

227  

2.2× and 1.6× higher than rate constants measured with RT-qPCR. This indicates that the

228  

MALDI-TOF-MS technique is sensitive to different photochemical products than the RT-qPCR

229  

technique.

230  

Previous research on nucleic acid photochemistry, primarily with DNA, has identified three

231  

major direct photochemical pathways.33-35 The first and second pathways involve reactions

232  

between neighboring pyrimidines that lead to the formation of cyclobutane pyrimidine dimers

233  

(CPD)36,37 and pyrimidine-pyrimidone 6-4 photoproducts (termed 6-4 products).38,39 A third

234  

pathway forms pyrimidine photohydrates when the reactions take place in aqueous solutions.40

235  

Reactions that form pyrimidine photohydrate products result in a mass change of +18.015 Da

236  

(=H2O), whereas the dimer products do not cause a mass change (Figure S5). In our experiments,

237  

more damage was detected using MALDI-TOF-MS compared to RT-qPCR, despite the fact that

238  

the MALDI-TOF-MS technique was not sensitive to the pyrimidine dimer products. This

239  

indicates that certain products were not efficiently detected with the RT enzymes.

240  

Pyrimidine hydrates were the major products detected in the UV-treated samples based on the

241  

product peaks in the MALDI-TOF-MS and high-resolution ESI-Orbitrap-MS spectra (Figure 2).

242  

Products of Oligomer A included a single pyrimidine photohydrate (mass difference of +18.02

243  

Da) and a double pyrimidine photohydrate (mass difference of +36.03 Da; Figure S6). The

244  

concentration of the single pyrimidine photohydrate product, monitored as the peak height of the

 

11   ACS Paragon Plus Environment

Environmental Science & Technology

245  

product relative to the internal standard, reached a maximum at a UV254 dose of 81.6 mJ/cm2 and

246  

then decreased until the final dose of 204 mJ/cm2 (Figure 2). A single pyrimidine photohydrate

247  

product of Oligomer B was also detected, but its intensity relative to the internal standard was

248  

lower than the corresponding Oligo A photohydrate product (Figure 2). A double pyrimidine

249  

photohydrate product of Oligomer B was not detected.

250  

Our results agree with an early report on RNA photochemistry that suggested hydrated

251  

residues are the major photoproducts after large doses of UVC irradiation.41 More recent studies

252  

tend to assume that pyrimidine dimers in RNA are the major photoproduct,42,43 likely because

253  

that is true for DNA.44 The discrepancy between RNA and DNA products may be due to the fact

254  

that the rate-limiting step of dimerization is the conformational change that creates favorable

255  

base alignment at the time of excitation, and this may be more prevalent with DNA.45

256  

The RT enzyme was inhibited or halted by certain RNA products, which may include

257  

pyrimidine dimers, pyrimidine hydrates, or some other products that have not been identified.

258  

Pyrimidine dimers are bulkier modifications than the hydrates (Figure S5) and thus may be more

259  

likely to impact the reverse transcriptase. Although the impact of pyrimidine dimers on RT has

260  

not been reported, DNA polymerase enzymes can be stopped by certain DNA modifications,

261  

depending on the type of DNA modification46 and on the specific polymerase. Taq polymerases,

262  

for example, do not read over pyrimidine dimer lesions, whereas A- and B- family polymerases

263  

do replicate sequences with pyrimidine dimers.47

264  

The decrease of RT-qPCR response through water treatment processes and environmental

265  

processes is often assumed to correlate with the loss of virus infectivity.21,48 There are issues with

266  

making this assumption, including that the inactivation pathway might not target the genome,2,49

267  

the RT-qPCR measures only a fraction of the viral genome,7,50 and that the RT enzyme might not

 

12   ACS Paragon Plus Environment

Page 12 of 25

Page 13 of 25

Environmental Science & Technology

268  

detect the same type of damage that inactivates the viral RNA genome. Whereas publications

269  

have addressed the first two points, the specific RNA chemistry that inactivates the virus and

270  

how that compares to RT-qPCR remains largely unexplored.

271  

Within the host cell, the genome of (+)ssRNA viruses (e.g., MS2, poliovirus, norovirus) must

272  

be sufficiently intact to serve as messenger RNA for the host cell ribosomes to make new virus

273  

proteins and to serve as a template for RNA dependent RNA polymerases to make new RNA

274  

genomes. With RT-qPCR, on the other hand, the RNA must be sufficiently intact for reverse

275  

transcriptase to make a complimentary DNA strand that is then amplified by PCR. Previously, a

276  

one-hit genome inactivation model was suggested for MS2 treatment with UV254 when RNA

277  

damage was monitored by RT-qPCR.7 In other words, the RNA modifications detected by RT-

278  

qPCR were sufficient to explain the extent of MS2 inactivation. In our experiments, much more

279  

RNA damage was detected by mass spectrometry than by RT-qPCR (Figure 1). Assuming the

280  

one-hit model with RT-qPCR detection is accurate for MS2 and other (+)ssRNA viruses, our

281  

data suggests a large fraction of UV254-induced RNA reaction products do not inactivate viruses.

282   283  

Direct Photochemical Reactions with Simulated Sunlight

284  

Neither Oligomer A or Oligomer B decreased significantly in concentration after 5 hours of

285  

simulated sunlight exposure, regardless of the method used to quantify the oligomer

286  

concentration (Figure 3). This dose of UVB solar irradiation (5100 J/m2 UVB and 1.2 x 105 J/m2

287  

UVA) is equivalent to approximately 1.5 hours of noontime irradiation in Ann Arbor, Michigan

288  

during the summer (Figure S1). Previous research suggests that direct photolysis plays a role in

289  

virus inactivation in sunlit waters, with UVB wavelengths causing most of the photoinactivation;

290  

20,51,52

 

we therefore anticipated reactions in the RNA oligomers.

13   ACS Paragon Plus Environment

Environmental Science & Technology

291  

The rate of MS2 inactivation was reportedly 0.22 h-1 in sensitizer-free water with UVA/UVB

292  

intensities similar to those used here.20 The explanation for our lack of detectable reaction is

293  

most likely due to the short RNA segments, which are only 0.7% of the length of the MS2

294  

genome. Although the data on RNA reactions due to solar radiation is scarce, the rate constants

295  

for pyrimidine dimer formation in dsDNA from UVA or UVB radiation was reportedly 1.4×10-7

296  

and 1.0×10-4 per kbp per J/m2 respectively.53 Rate constants for the formation of other DNA

297  

photoproducts with UVA and UVB were not readily available in the literature. We applied these

298  

reaction rate constants for DNA pyrimidine dimer formation to the full MS2 RNA genome and

299  

our 24-mer oligomers. For the MS2 genome, the predicted pyrimidine formation rates were

300  

approximately 2 – 5× faster than the MS2 direct photoinactivation rates reported by Silverman et

301  

al.20 There are several potential explanations for this discrepancy, including that reactions may

302  

be slower in RNA than in DNA, that incorporation in a virus particle may influence the RNA

303  

reaction kinetics, that there were differences in the UVA/UVB spectra emitted by the lamps, and

304  

that other products are responsible for inactivating the MS2 genome. Regardless of the reason for

305  

the discrepancy, the DNA pyrimidine formation rate constants did an adequate job of predicting

306  

MS2 inactivation with sunlight. When these same rate constants were applied to our 24-mer

307  

oligomers, calculations predicted a ~3% decrease in oligomer concentration due to pyrimidine

308  

dimer formation after 5 hours of solar simulator irradiation. This is in agreement with our lack of

309  

observed oligomer decay with RT-qPCR and mass spectrometry over the experiment timeframe.

310  

Future experiments should expose RNA oligomers in our size range to much higher solar UV

311  

doses (e.g., >50,000 J/m2 of solar UVB) in order to readily observe reactions in the oligomers.

312   313  

Indirect Photochemical Reactions with Simulated Sunlight

 

14   ACS Paragon Plus Environment

Page 14 of 25

Page 15 of 25

Environmental Science & Technology

314  

When irradiated in the presence of the Rose Bengal sensitizer, Oligomers A and B decreased

315  

in concentration according to first order kinetics and Oligomer B decreased more rapidly than

316  

Oligomer A (Figure 4). This trend in reactivity with 1O2 is opposite than what was observed in

317  

the direct photochemical reactions and is most likely due to the relative number of guanine bases

318  

in the oligomers (10 in Oligomer B and 1 in Oligomer A). Whereas uracil and cytosine are the

319  

most sensitive bases to direct photo-oxidation, guanine bases are the most reactive with 1O2 and

320  

other oxidants.54

321  

There was no statistical difference in reaction kinetics measured by quantitative MALDI-TOF-

322  

MS and RT-qPCR (Figure 4, Table 2), suggesting that the same 1O2-induced RNA damage is

323  

detected by both techniques. It should be noted that reactions between the oligomers and 1O2

324  

resulted in products that interfered with the MALDI oligomer peaks. Consequently, we limited

325  

the oligomer measurements by MALDI-TOF-MS to the initial 50% of the Oligomer A and

326  

Oliogmer B reactions (Figure 4). This product interference was not observed with RT-qPCR

327  

measurements, so the oligomer reactions were monitored by RT-qPCR over the entire

328  

experimental timeframe (i.e., 100 minutes). Previous research demonstrated that oxidative

329  

damage in RNA inhibited the synthesis of cDNA by RT, although the products were not

330  

identified.55 Here, following thirty minutes of 1O2 exposure, ESI-Orbitrap-MS detected a major

331  

product for Oligomer A and two major products for Oligomer B (Figure 5). The Oligomer A

332  

product had a mass of 7469.579 Da; this product, which is 16.05 Da heavier than the reactant,

333  

likely involves the formation of an 8-hydroxyguanosine (8-OHG) adduct, which is a common

334  

marker for RNA oxidation. Products of Oligomer B included a species with mass change of

335  

+6.00 Da (Product B1) and a species with a mass change of +13.00 Da (Product B2; Figure 5).

336  

The masses of Product B1 and Product B2 are not indicative of common RNA adducts reported

 

15   ACS Paragon Plus Environment

Environmental Science & Technology

337  

in the literature, such as 8-hydroxyadenosine, 5-hydroxycytidine, and 5-hydroxyuridine. The

338  

products were not resolved with chromatography, thus the fragmentation data was inconclusive.

339  

Reported reaction rate constants for 1O2 with RNA monomer bases offer an opportunity to

340  

relate our results with established chemical kinetics.54,56 By summing up the reported rate

341  

constants of the individual bases in our oligomers, we predicted second order rate constants of

342  

7.8 x 106 M-1s-1 for Oligomer A and 1.3 x 107 M-1s-1 for Oligomer B (Table S2). The predicted

343  

rate constants are 7× and 2× higher than the measured rate constants, respectively. This may be

344  

due to inaccuracies in the reported 1O2 rate constants (see discussion in SI) or due to the impact

345  

of primary structure on base reactivity. The predicted rates do agree with our finding that 1O2 is

346  

more reactive with Oligomer B than with Oligomer A.

347  

The impact that RNA oxidation products have on viral RNA-dependent RNA polymerases

348  

has not been studied, but the major DNA oxidation product 8-oxoG leads to mutations during

349  

transcription by DNA-dependent RNA polymerases.57,58 If RNA-dependent RNA polymerases

350  

undergo the same error, oxidation products in the genome may cause mutations that lead to non-

351  

infective viruses. Likewise, oxidized mRNAs can cause ribosome stalling and thus result in

352  

defective proteins synthesis;58-61 in viral RNA, this may lead to incomplete or flawed viral

353  

capsids that are unable to recognize and interact with host cells.

354   355  

Environmental Implications

356  

We studied the photochemical reactivity of purified MS2 RNA oligomers to understand the

357  

influence of genome sequence on RNA reactivity during water disinfection processes. Our

358  

results demonstrate that different regions of viral RNA genomes have distinct photoreactivities

359  

and regions that are most susceptible to direct photolysis may be least susceptible to indirect

 

16   ACS Paragon Plus Environment

Page 16 of 25

Page 17 of 25

Environmental Science & Technology

360  

photolysis. Furthermore, not all of the photochemical reactions that take place in RNA were

361  

readily detectable by RT-qPCR or MS, which has direct implications for analytical techniques

362  

used to define reaction kinetics. Because the detection of RNA modifications that cause virus

363  

inactivation are of most interest, future research efforts should seek out the RNA products that

364  

inhibit RNA-dependent RNA polymerases and ribosomes.

365  

RNA bases incorporated in a virus particle likely react differently than RNA bases in an

366  

oligomer. We expect that the direct photolysis reaction rate constants observed in our 24-mers

367  

with UV254 would vary slightly when they are incorporated in the full virus, with additional

368  

products forming due to interactions between the RNA and capsid proteins. With indirect

369  

photolysis involving 1O2, we expect that reaction rate constants would be significantly reduced

370  

when the oligomers are incorporated into the virus particle due to the fact that the protein capsid

371  

and RNA genome reduce the accessibility of 1O2 to the RNA oligomers. RNA-protein

372  

interactions in virus particles likely cause additional RNA oxidation products. The exact impact

373  

that RNA higher-level order has on RNA base photochemistry reactivity remains to be

374  

investigated. Filling these remaining fundamental knowledge gaps on RNA photochemistry and

375  

the biological significance of photochemical products will not only be important for

376  

understanding the inactivation of waterborne viruses, but across all domains of life in natural and

377  

engineered waters exposed to photochemical stresses.

378  

 

379  

Supporting Information Available. The accompanying SI material includes descriptions of our

380  

rate constant calculations, spectra of the solar simulator output and solar spectrum in Ann Arbor,

381  

MI, a figure of 1O2 concentration measurements, calibration curves for quantitative MALDI-

382  

TOF-MS and RT-qPCR methods, chemical structures of RNA photochemical and oxidation

383  

products, a high-resolution M.S. spectra for a UV double photohydrate product, a table of our LC  

17   ACS Paragon Plus Environment

Environmental Science & Technology

Page 18 of 25

384  

gradient profile, and a table of our 1O2 rate constant predictions. This information is available

385  

free of charge via the Internet at http://pubs.acs.org.

386  

Author Information

387  

Corresponding author

388  

*Phone: +1- (734)-763-9661; e-mail: [email protected]

389   390  

Acknowledgment

391  

This research was supported by National Science Foundation (NSF) BRIGE Award #1329576.

392  

We thank James Windak from University of Michigan for his help with MALDI-TOF-MS

393  

analysis, Thomas Yavaraski and Sergey Chernyak from University of Michigan for their

394  

assistance with ESI-Orbitrap-MS measurements, and Collin Ward and Rose Cory for their help

395  

with simulated sunlight experiments.  

396  

 

Oligomer B

0.0

0.0

-0.2

-0.2

log10 (C/C0)

log10 (C/C0)

Oligomer A

-0.4

-0.6

0

50

100

UV dose

150

-0.4

-0.6

200

RT-qPCR MALDI-TOF 0

50

(mJ/cm2)

100

UV dose

150

200

(mJ/cm2)

397   398  

Figure 1. Reactions of two MS2 viral RNA oligomers with UV254 irradiation measured by RT-

399  

qPCR and quantitative MALDI-TOF-MS. Experiments were run in triplicate. Experimental

400  

conditions: [RNA segment]0 = 4 µM in nuclease free water, pH 6.2.

 

18   ACS Paragon Plus Environment

Environmental Science & Technology

A

746.39570 z=10

4×10 6

745.69643 z=10

6×10

5

4×10 5 2×10 5

783.91028 z=10 783.81022 z=10

784.20851 z=10 784.11044 z=10

784.60712 z=10 784.70719 z=10 784.80703 z=10

783.71022 z=10

8 78

4.

6

4

4. 78

4.

2

78

4.

0

78

8 3.

4. 78

8

0 7. 74

6

6.

6.

74

4 6.

m/z

401  

74

2

0 6.

6.

74

74

8

0

5. 74

5.

6

0

74

746.49544 z=10 746.59542 z=10 746.79476 z=10

745.79620 z=10

2×10 6

784.40746 z=10 784.50724 z=10

784.30785 z=10

8×10 5

746.29608 z=10

745.89620 z=10

B

78

6×10 6

74

Intensity

8×10 6

1×10 6

746.09633 z=10 746.19592 745.99647 z=10 z=10

Intensity

1×10 7

Intensity ratio of product peak to IS peak

Page 19 of 25

0.8 0.6

Oligo A

C

Oligo B

0.4 0.2 0.0

0

50

100

150

200

UV dose (mJ/cm2)

m/z

402  

Figure 2. Pyrimidine photohydrates resulting from reactions of oligomers with UV254. A) High-

403  

resolution mass spectrum of Oligomer A pyrimidine photohydrate product with -10 charge. B)

404  

High-resolution mass spectrum of Oligomer B pyrimidine photohydrate product with -10 charge.

405  

C) Ratio of pyrimidine photohydrates peak intensities to internal standard peak intensities (26-

406  

mer internal standards with constant concentration of 2 µM), measured with MALDI-TOF-MS.

407  

Experimental error bars represent standard error (n = 3 experiments); some error bars are smaller

408  

than the symbols. Oligomer B

0.1

0.1

-0.1

-0.1

log10 (C/C0)

log10 (C/C0)

Oligomer A

-0.3

-0.5

-0.5 0

409  

-0.3

1

2

3

Time (h)

4

0

5

RT-qPCR

DarkControl (qPCR)

MALDI-TOF

DarkControl (MALDI)

1

3

2

4

5

Time (h)

410  

Figure 3. Reaction of two MS2 viral RNA oligomers with simulated solar irradiation measured

411  

by RT-qPCR and quantitative MALDI-TOF-MS. Control experiments were conducted in dark

412  

environment at the same time. Experiments were run in duplicate. Experimental conditions:

413  

[RNA segment]0 = 1.3 µM in nuclease free water, pH 6.2.

 

19   ACS Paragon Plus Environment

Environmental Science & Technology

Page 20 of 25

Oligomer A 0.1

log10 (C/C0)

0.0 -0.1 -0.2 -0.3 0

20

40

60

80

100

Time (mins)

RT-qPCR MALDI-TOF DarkControl (qPCR)

Oligomer B

DarkControl (MALDI)

log10 (C/C0)

0.0 -0.5 -1.0 -1.5

0

20

40

60

80

100

Time (mins) 414   415  

Figure 4. Reaction of two MS2 viral RNA oligomers with 1O2 measured by RT-qPCR and

416  

quantitative MALDI-TOF-MS. Control experiments were conducted in dark environment at the

417  

same time. Experiments were run in triplicate. Experimental conditions: [RNA segment]0 = 1.0

418  

µM in 1.5 mg/L Rose Bengal solution, pH 6.6.

 

20   ACS Paragon Plus Environment

Page 21 of 25

Environmental Science & Technology

A

B

0 mins

2.0×10

5

930.6835 [OligoA-8H]8-

2.0×10

1.0×10 5 5.0×10 4 0.0

1.0×10 5 5.0×10 4

930

931

m/z

932

0.0 1564

933

1566

4

Intensity

Intensity

2×10 4 1×10 4 931

m/z

932

6×10 4

0 1564

933

1566

4×10

4

930.6832 [OligoA-8H]8-

3×10 4

3×10 4 2×10 4 1×10 4 0

419  

932.6895 [Product A-8H]8-

930

931

m/z

1568

m/z

30 mins

Intensity

Intensity

5×10

1572

4×10 4

30 mins 4

1570

1566.7908 [Product B1-5H]5-

2×10 4

932.6878 [Product A-8H]8-

930

1572

1565.5847 [OligoB-5H]5-

8×10 4

3×10 4

0

1570

15 mins

930.6828 [OligoA-8H]8-

4×10 4

1568

m/z

15 mins 5×10

0 mins

1.5×10 5

Intensity

Intensity

1.5×10 5

1565.5812 [OligoB-5H]5-

5

932

1566.7603 [Product B1-5H]51565.5733 [OligoB-5H]5-

2×10 4

1×10 4

0 1564

933

1568.1608 [Product B2-5H]5-

1566

1568

m/z

1570

1572

420  

Figure 5. High-resolution mass spectra of two MS2 viral RNA oligomers treated with 1O2 for 0,

421  

15 and 30 minutes, obtained by ESI-Orbitrap-MS under full-scan negative-ion mode. A)

422  

Oligomer A and reaction products. A) Oligomer B and reaction products.

423  

 

21   ACS Paragon Plus Environment

Environmental Science & Technology

Page 22 of 25

424  

Table 1. The sequences and masses of the RNA oligonucleotides from MS2 genome and

425  

corresponding internal standards. RNA segment

Sequence

Oligomer A

5’- 982AUCCAUAUCACACCCUUUUCCACG1005 -3’

Oligomer A Internal Standard

5’- AUCCAUAUCACACCCUUUUCCACGAU -3’

Oligomer B Oligomer B Internal Standard

5’- 168UGGAAGCAGGGAUCGCAGGCGCAA191-3’ 5’- UGGAAGCAGGGAUCGCAGGCGCAAAU-3’

Average Mass Monoisotopic Mass (Da) 7453.521 7449.990 8088.898 8085.067 7832.846 7829.137 8468.224 8464.214

426   427   428  

Table 2. First order rate constants of oligomer reactions with UV254 and second order rate

429  

constants of oligomer reactions with 1O2 measured with RT-qPCR and quantitative MALDI-MS.

430  

Errors reflect the 95% confident internal values of rate constants, based on a single linear

431  

regression of triplicate experimental data. Arrows indicate there are significant differences

432  

between rate constants (p < 0.05; multiple linear regression test). UV254 (mJ-1cm2) MALDI-MS RT-qPCR

RNA Segment

O2 (M-1s-1) MALDI-MS RT-qPCR

Oligomer A

5.7 x 10-3 ± 2.5 x 10-4

2.6 x 10-3 ± 2.0 x 10-4

1.1 x 106 ± 6.1 x 104

1.1 x 106 ± 1.4 x 105

Oligomer B

1.9 x 10-3 ± 1.4 x 10-4

1.2 x 10-3 ± 3.4 x 10-4

5.9 x 106 ± 6.1 x 105

6.5 x 106 ± 3.3 x 105

433  

 

434   435   436  

   

437   438   439   440   441  

1

References:   (1) (2)  

Rodríguez-Lázaro, D.; Cook, N.; Ruggeri, F. M.; Sellwood, J.; Nasser, A.; Nascimento, M. S. J.; D'Agostino, M.; Santos, R.; Saiz, J. C.; Rzeżutka, A.; et al. Virus hazards from food, water and other contaminated environments. FEMS Microbiol. Rev. 2012, 36 (4), 786–814. Wigginton, K. R.; Pecson, B. M.; Sigstam, T.; Bosshard, F.; Kohn, T. Virus inactivation 22   ACS Paragon Plus Environment

Page 23 of 25

442   443   444   445   446   447   448   449   450   451   452   453   454   455   456   457   458   459   460   461   462   463   464   465   466   467   468   469   470   471   472   473   474   475   476   477   478   479   480   481   482   483   484   485   486   487   488   489   490   491   492  

Environmental Science & Technology

(3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) (15) (16) (17) (18)

(19) (20) (21) (22)

 

mechanisms: impact of disinfectants on virus function and structural integrity. Environ. Sci. Technol. 2012, 46 (21), 12069–12078. Wigginton, K. R.; Menin, L.; Sigstam, T.; Gannon, G.; Cascella, M.; Hamidane, H. B.; Tsybin, Y. O.; Waridel, P.; Kohn, T. UV radiation induces genome‐mediated, site‐specific cleavage in viral proteins. ChemBioChem 2012, 13 (6), 837–845. Sigstam, T.; Rohatschek, A.; Zhong, Q.; Brennecke, M.; Kohn, T. On the cause of the tailing phenomenon during virus disinfection by chlorine dioxide. Water Res. 2014, 48 (C), 82–89. Eischeid, A. C.; Linden, K. G. Molecular indications of protein damage in adenoviruses after UV disinfection. Appl. Environ. Microbiol. 2011, 77 (3), 1145–1147. Thurman, R. B.; Gerba, C. P. Molecular mechanisms of viral inactivation by water disinfectants. Adv. Appl. Microbiol. 1988, 33, 75–105. Pecson, B. M.; Ackermann, M.; Kohn, T. Framework for using quantitative PCR as a nonculture based method to estimate virus infectivity. Environ. Sci. Technol. 2011, 45 (6), 2257–2263. Davis-Colley, R. J.; Donnison, A. M.; Speed, D. J. Towards a mechanistic understanding of pond disinfection. Water Sci. Technol. 2000, 42 (10-11), 149–158. Jagger, J. Solar-UV actions on living cells. 1985. Kohn, T.; Nelson, K. L. Sunlight-mediated inactivation of MS2 coliphage via exogenous singlet oxygen produced by sensitizers in natural waters. Environ. Sci. Technol. 2006, 41 (1), 192–197. Harm, W. Biological effects of ultraviolet radiation. Int. Union Pure Appl. Bio 1980, 1. Cadet, J.; Teoule, R. Comparative study of oxidation of nucleic acid components by hydroxyl radicals, singlet oxygen and superoxide anion radicals. Photochem. Photobiol. 1978, 28 (4‐5), 661–665. Steen Steenken, A.; Jovanovic, S. V. How easily oxidizable is DNA? One-electron reduction potentials of adenosine and guanosine radicals in aqueous solution. J. Am. Chem. Soc. 1997, 119 (3), 617–618. Devasagayam, T. P. A.; Steenken, S.; Obendorf, M. S. W.; Schulz, W. A.; Sies, H. Formation of 8-hydroxy(deoxy)guanosine and generation of strand breaks at guanine residues in DNA by singlet oxygen. Biochemistry 2002, 30 (25), 6283–6289. Kvam, E.; Berg, K.; Steen, H. B. Characterization of singlet oxygen-induced guanine residue damage after photochemical treatment of free nucleosides and DNA. BBA-Gene Struct. Expr. 1994, 1217 (1), 1–8. Cadet, J.; Berger, M.; Douki, T.; Morin, B.; Raoul, S. Effects of UV and visible radiation on DNA-final base damage. Biol. Chem. 1997, 378 (11), 1275–1286. Ravanat, J.-L.; Martinez, G. R.; Medeiros, M. H. G.; Di Mascio, P.; Cadet, J. Mechanistic aspects of the oxidation of DNA constituents mediated by singlet molecular oxygen. Arch. Biochem. Biophys. 2004, 423 (1), 23–30. Fraisse, A.; Temmam, S.; Deboosere, N.; Guillier, L.; Delobel, A.; Maris, P.; Vialette, M.; Morin, T.; Perelle, S. Comparison of chlorine and peroxyacetic-based disinfectant to inactivate Feline calicivirus, Murine norovirus and Hepatitis A virus on lettuce. Int. J. Food Microbiol. 2011, 151 (1), 98–104. Fujioka, R. S.; Yoneyama, B. S. Sunlight inactivation of human enteric viruses and fecal bacteria. Water Sci. Technol. 2002, 46 (11-12), 291–295. Silverman, A. I.; Peterson, B. M.; Boehm, A. B.; McNeill, K.; Nelson, K. L. Sunlight inactivation of human viruses and bacteriophages in coastal waters containing natural photosensitizers. Environ. Sci. Technol. 2013, 47 (4), 1870–1878. Albinana-Gimenez, N.; Miagostovich, M. P.; Calgua, B.; Huguet, J. M.; Matia, L.; Girones, R. Analysis of adenoviruses and polyomaviruses quantified by qPCR as indicators of water quality in source and drinking-water treatment plants. Water Res. 2009, 43 (7), 2011–2019. Kitajima, M.; Iker, B. C.; Pepper, I. L.; Gerba, C. P. Relative abundance and treatment reduction of viruses during wastewater treatment processes — Identification of potential viral indicators. Sci. Total Environ. 2014, 488-489, 290–296. 23   ACS Paragon Plus Environment

Environmental Science & Technology

493   494   495   496   497   498   499   500   501   502   503   504   505   506   507   508   509   510   511   512   513   514   515   516   517   518   519   520   521   522   523   524   525   526   527   528   529   530   531   532   533   534   535   536   537   538   539   540   541   542   543  

(23) (24) (25) (26) (27) (28) (29) (30) (31) (32) (33) (34) (35) (36) (37) (38) (39) (40) (41) (42) (43)

 

Lo, Y. M. D.; Leung, S.-F.; Chan, L. Y. S.; Chan, A. T. C.; Lo, K.-W.; Johnson, P. J.; Huang, D. P. Kinetics of Plasma Epstein-Barr Virus DNA during radiation therapy for nasopharyngeal carcinoma. Cancer Res. 2000, 60 (9), 2351–2355. Calgua, B.; Carratalà, A.; Guerrero-Latorre, L.; de Abreu Corrêa, A.; Kohn, T.; Sommer, R.; Girones, R. UVC inactivation of dsDNA and ssRNA viruses in water: UV fluences and a qPCRbased approach to evaluate decay on viral infectivity. Food Environ. Virol. 2014, 6 (4), 260–268. Lane, D. J.; Pace, B.; Olsen, G. J.; Stahl, D. A.; Sogin, M. L.; Pace, N. R. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. U.S.A. 1985, 82 (20), 6955–6959. Kohn, T.; Nelson, K. L. Sunlight-mediated inactivation of MS2 coliphage via exogenous singlet oxygen produced by sensitizers in natural waters. Environ. Sci. Technol. 2006, 41 (1), 192–197. Rahn, R. O. Potassium iodide as a chemical actinometer for 254 nm radiation: use of iodate as an electron scavenger. Photochem. Photobiol. 1997, 66 (6), 885–885. Chen, C.; Ridzon, D. A.; Broomer, A. J.; Zhou, Z.; Lee, D. H.; Nguyen, J. T.; Barbisin, M.; Xu, N. L.; Mahuvakar, V. R.; Andersen, M. R.; et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33 (20), e179–e179. Sun, S. Analysis and quantification of oligonucleotides. AB SCIEX Technical Note 2010, 1–2. Ravanat, J.-L.; Douki, T.; Cadet, J. Direct and indirect effects of UV radiation on DNA and its components. J. Photoch. Photobio. B 2001, 63 (1-3), 88–102. Gorner, H. Photochemistry of DNA and related biomolecules: quantum yields and consequences of photoionization. J. Photoch. Photobio. B 1994, 117–139. Miller, R. L.; Plagemann, P. Effect of ultraviolet light on mengovirus: formation of uracil dimers, instability and degradation of capsid, and covalent linkage of protein to viral RNA. J. Virol. 1974, 13 (3), 729–739. Barbatti, M.; Aquino, A.; Szymczak, J. J. Relaxation mechanisms of UV-photoexcited DNA and RNA nucleobases. Proc. Natl. Acad. Sci. U.S.A. 2010, 107 (50), 21453–21458. Cadet, J.; Sage, E.; Douki, T. Ultraviolet radiation-mediated damage to cellular DNA. Mutat. Res.-Fund. Mol. M. 2005, 571 (1-2), 3–17. Cadet, J.; Anselmino, C.; Douki, T.; Voituriez, L. New trends in photobiology: Photochemistry of nucleic acids in cells. J. Photoch. Photobio. B 1992, 15 (4), 277–298. Patrick, M. H.; Snow, J. M. Studies on thymine‐derived UV photo‐products in DNA—ii. a comparative analysis of damage caused by 254 nm irradiation and triplet‐state photosensitization. Photochem. Photobiol. 1977, 25 (4), 373–384. Setlow, R. B.; Setlow, J. K. Evidence that ultraviolet-induced thymine dimers in DNA cause biological damage. Proc. Natl. Acad. Sci. U.S.A. 1962, 48 (7), 1250–1257. Kan, L. S.; Voituriez, L.; Cadet, J. The Dewar valence isomer of the (6-4) photoadduct of thymidylyl-(3′–5′)-thymidine monophosphate: Formation, alkaline lability and conformations properties. J. Photoch. Photobio. B 1992, 12 (4), 339–357. Mitchell, D. L.; Applegate, L. A.; Nairn, R. S. Photoreactivation of cyclobutane dimers and (6-4) photoproducts in the epidermis of the marsupial, Monodelphis domestica. Photochem. Photobiol. 1990, 51 (6), 653–658. Ravanat, J. L.; Douki, T.; Cadet, J. UV damage to nucleic acid components. Compr. Seri. Photosci. 2001, 3, 207–230. Swenson, P. A.; Setlow, R. B. Kinetics of dimer formation and photohydration in ultraviolet‐ irradiated polyuridylic acid. Photochem. Photobiol. 1963, 2 (4), 419–434. Beck, S. E.; Rodríguez, R. A.; Hawkins, M. A.; Hargy, T. M.; Larason, T. C.; Linden, K. G. Comparison of UV-induced inactivation and RNA damage in MS2 phage across the germicidal UV spectrum. Appl. Environ. Microbiol. 2015, 82 (5), 1468-1474. Climent, T.; González-Ramírez, I.; González-Luque, R.; Merchán, M.; Serrano-Andrés, L. Cyclobutane Pyrimidine Photodimerization of DNA/RNA Nucleobases in the Triplet State. J. Phys. Chem. Lett. 2010, 1 (14), 2072–2076. 24   ACS Paragon Plus Environment

Page 24 of 25

Page 25 of 25

544   545   546   547   548   549   550   551   552   553   554   555   556   557   558   559   560   561   562   563   564   565   566   567   568   569   570   571   572   573   574   575   576   577   578   579   580   581   582   583   584   585   586   587   588   589   590  

Environmental Science & Technology

(44) (45) (46) (47) (48) (49) (50) (51) (52) (53) (54) (55) (56) (57) (58) (59) (60) (61)  

 

Görner, H. New trends in photobiology: Photochemistry of DNA and related biomolecules: Quantum yields and consequences of photoionization. J. Photoch. Photobio. B 1994, 26 (2), 117–139. Schreier, W. J.; Schrader, T. E.; Koller, F. O.; Gilch, P.; Crespo-Hernández, C. E.; Swaminathan, V. N.; Carell, T.; Zinth, W.; Kohler, B. Thymine dimerization in DNA is an ultrafast photoreaction. Science 2007, 315 (5812), 625–629. Sikorsky, J. A.; Primerano, D. A.; Fenger, T. W.; Denvir, J. Effect of DNA damage on PCR amplification efficiency with the relative threshold cycle method. Biochem. Bioph. Res. Co. 2004, 323 (3), 823–830. McDonald, J. P.; Hall, A.; Gasparutto, D.; Cadet, J.; Ballantyne, J.; Woodgate, R. Novel thermostable Y-family polymerases: applications for the PCR amplification of damaged or ancient DNAs. Nucleic Acids Res. 2006, 34 (4), 1102–1111. Polo, D.; García-Fernández, I. Solar water disinfection (SODIS): Impact on hepatitis A virus and on a human Norovirus surrogate under natural solar conditions. Int. Microbiol. 2015, 18 (1), 41– 49. Bosshard, F.; Armand, F.; Hamelin, R.; Kohn, T. Mechanisms of human adenovirus inactivation by sunlight and UVC light as examined by quantitative PCR and quantitative proteomics. Appl. Environ. Microbiol. 2013, 79 (4), 1325–1332. Simonet, J.; Gantzer, C. Degradation of the Poliovirus 1 genome by chlorine dioxide. J. Appl. Microbiol. 2006, 100 (4), 862–870. Silverman, A. I.; Nguyen, M. T.; Schilling, I. E.; Wenk, J.; Nelson, K. L. Sunlight inactivation of viruses in open-water unit process treatment wetlands: modeling endogenous and exogenous inactivation rates. Environ. Sci. Technol. 2015, 49 (5), 2757–2766. Kohn, T.; Mattle, M. J.; Minella, M.; Vione, D. A modeling approach to estimate the solar disinfection of viral indicator organisms in waste stabilization ponds and surface waters. Water Res. 2016, 88, 912–922. Kuluncsics, Z.; Perdiz, D.; Brulay, E.; Muel, B.; Sage, E. Wavelength dependence of ultravioletinduced DNA damage distribution: Involvement of direct or indirect mechanisms and possible artefacts. J. Photoch. Photobio. B 1999, 49 (1), 71–80. Clagett, D. C.; Galen, T. J. Ribonucleoside reactivities with singlet (1Δg) molecular oxygen. Arch. Biochem. Biophys. 1971, 146 (1), 196–201. Gong, X.; Tao, R.; Li, Z. Quantification of RNA damage by reverse transcription polymerase chain reactions. Anal. Biochem. 2006, 357 (1), 58–67. Wilkinson, F.; Helman, W. P.; Ross, A. B. Rate constants for the decay and reactions of the lowest electronically excited singlet state of molecular oxygen in solution. An expanded and revised compilation. J. Phys. Chem. Ref. Data 1995, 24 (2), 663–677. Shibutani, S.; Takeshita, M.; Grollman, A. P. Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature 1991, 349 (6308), 431–434. Simms, C. L.; Hudson, B. H.; Mosior, J. W.; Rangwala, A. S.; Zaher, H. S. An active role for the ribosome in determining the fate of oxidized mRNA. Cell Reports 2014, 9 (4), 1256–1264. Shan, X.; Chang, Y.; Lin, C.-L. G. Messenger RNA oxidation is an early event preceding cell death and causes reduced protein expression. FASEB J 2007, 21 (11), 2753–2764. Shan, X.; Tashiro, H.; Lin, C. G. The identification and characterization of oxidized RNAs in Alzheimer's disease. J. Neurosci. 2003, 23 (12), 4913–4921. Tanaka, M.; Chock, P. B.; Stadtman, E. R. Oxidized messenger RNA induces translation errors. Proc. Natl. Acad. Sci. U.S.A. 2007, 104 (1), 66–71.

25   ACS Paragon Plus Environment